Biopython: Working with Sequences

In this part we want to learn how to work with nucleotide and amino acid sequence files. For this we will use the package Biopython, which provides a lot of functions to read/modify/write sequence files.

By default Anaconda does not come with Biopython installed. But you can easily do this by opening a new terminal on your machine and running the following command:

conda install biopython

It will ask you whether you want to newly install the package, answer yes and wait for a bit for the installation to finish.

Reading sequence files

The most common sequence formats you will encounter are *.fasta (the file ending is also sometimes written as *.fa) and *.fastq (or *.fq). Biopython comes with functions to read in these files. These can be found in the SeqIO module (see the link for further supported file formats if you're interested in that).

Download some test-sequences which are in sequences.zip and extract them in your Downloads folder.

In [1]:
# you can load the SeqIO module from Biopython in the following way
from Bio import SeqIO

# to open and read a file, sequence by sequence, you can use the following command
for sequence in SeqIO.parse("sequences/coding_sequences.fasta","fasta"):
    print(sequence)
    break
ID: Laspu_000001
Name: Laspu_000001
Description: Laspu_000001
Number of features: 0
Seq('ATGCCTTCGCAAGAGGATTGCATTCAAAAAGATCCCTCCAAGTATCCCAATGAG...TGA', SingleLetterAlphabet())

The function SeqIO.parse() opens a file and reads it. The first positional parameter gives the location of the file we want to read (in this case sequences/coding_sequences.fasta), the second parameter specifies the file format (here a simple fasta). The easiest way to use SeqIO is in a simple for-loop. Unlike the regular for i in open(file,"r"), which returns a single line per loop-iteration, a for-loop with SeqIO returns a single sequence object per line.

note: we only use the break to keep the output clean, this stops the loop after the first iteration, so that we won't get all sequences printed into our jupyter notebook.

Printing a single sequence we see that the returned object contains not only the sequence as Seq, but also some metadata, like the ID, Name and Description. We can access the individual fields of the sequence object like this:

In [2]:
for sequence in SeqIO.parse("sequences/coding_sequences.fasta","fasta"):
    print("this is the sequence name:", sequence.name)
    print("this is the sequence itself:", sequence.seq)
    break
this is the sequence name: Laspu_000001
this is the sequence itself: ATGCCTTCGCAAGAGGATTGCATTCAAAAAGATCCCTCCAAGTATCCCAATGAGATGGCTTGGTCGCACCGCTTTCAATATCTACCGTTTGATGTCAAATTTGACAAGAGAGGCGAAGGAGGGTCTCATACCAGAGTAATCAGCTACATCAACAACGTACACCCAGCAGCCCACCAATACTTCTACAGCGTTGTAGAAAAATTGATCGACGTAACCATCCCCATGTTCAACCAAACACTCACAGACATCAAAGCCCCCGGCTACTCAAATCAGCGTTTCCACGTCGCCGTCCTAGGACGCGACCCTATGATCGTAAAAGAACCAGGGGATTTCCATCCACCCCAACAGCGAGCCACACGACAATGGCTAGATTCCCAAGGCCGCTTCCAAGATTGGCTATTTGTAGATCTGGAGAAGGAGTTCTGGAACATTGGCCTGCAAATGATCCTGCGCGTTACAGAAATCAACCTCACCCCCGAAAAGCCGCGCTATGATGGTGAGGAATGGCATGTCCAGGGGCGAATGAATGAGCGTATTTGCGCCACTGCAGTCTACACCTACGGTATTCACAACACGACGCCGGCTTCCCTCTCCTTCCGCCGCCGCATTAACGCCGAAGAAGCCATGCTCGCCAAGGACTACATCCAGTCCCCGCCCTGGGCGCCTGAGCTCTACGGCGCCCGCTCCGGCGACCCGGTCATCCAGCATATGGGCGACATCACTATTTCTGAGAACCGGCTCGTCACATACCCGAACATCTTCCAAACGCGCTTGCTCCCGATTGAGCTAGTTGATATGAGCAAGCCAGGCCACGTCAAGCTACTAACGCTGCATCTTGTCGACCCCAACAGACGGATGATGAGCACAGCCATGGTACCGCCCCAACGGCGGGACTGGTGGGCGCGAGAGGTAAGGGTGGACAATGCGAGGTTTTGGCGGCTGCCCAGAGAGGTCTGGGATAAGATCGTGGAGATGGTGGACGAGTATCCGATAGGGACGGAGGAAGGGGAGGAAATGAGGCAGGAGTTTAAGGCGGAAAGTGAGAGGGCGAGGGAGAAGCATACGAGGGCTATGATGAATTATTTGGAGTGGGATTTGGATTGGGAAGATAATGATTCGGTCTATGTGTGA

The sequence.seq object can be sliced like a regular string:

In [3]:
print(sequence.seq[0:10])
ATGCCTTCGC

But while the sequence.seq content looks like a regular string, it is indeed a special data type:

In [4]:
type(sequence.seq)
Out[4]:
Bio.Seq.Seq

Thanks to this we can access some special functions which would not be available for regular strings:

In [5]:
print("sequence:", sequence.seq[0:10])
print("complement:", sequence.seq.complement()[:10])
print("---")
print("reverse:", sequence.seq[-10:][::-1])
print("reverse complement:", sequence.seq.reverse_complement()[:10])
sequence: ATGCCTTCGC
complement: TACGGAAGCG
---
reverse: AGTGTGTATC
reverse complement: TCACACATAG

We can not only get the complement and reverse complement, but also directly translate a coding sequence to amino acids:

In [6]:
sequence.seq.translate()
Out[6]:
Seq('MPSQEDCIQKDPSKYPNEMAWSHRFQYLPFDVKFDKRGEGGSHTRVISYINNVH...YV*', HasStopCodon(ExtendedIUPACProtein(), '*'))

You can also write sequence files using SeqIO. For this you can open a new file-handle and subsequently use the SeqIO.write() function to write.

tip: this can easily be used for converting files from one format to another

In [7]:
with open("example.faa", "w") as handle:
    SeqIO.write(sequence, handle, "fasta")
handle.close()

Tasks

  1. Read the sequences in coding_sequences.fasta, calculate the overall G/C content for each of the sequences and save them in a dictionary, using the sequence.name as the key and the G/C content as the value.
  2. Translate the sequences in coding_sequences.fasta to amino acids and save them in a new file called proteins.fasta.
  3. Some tools don't like to have the terminal stop codons * in the translated amino acids. Additionally create a second file proteins_no_stop.fasta, which does not contain the *.

Reading FASTQ

fastq files can be read in the same way that fasta files are:

In [8]:
for sequence in SeqIO.parse("sequences/rp_forward.fastq","fastq"):
    print(sequence)
    break
ID: M01527:37:000000000-A59BM:1:1101:13813:1836
Name: M01527:37:000000000-A59BM:1:1101:13813:1836
Description: M01527:37:000000000-A59BM:1:1101:13813:1836 1:N:0:1
Number of features: 0
Per letter annotation for: phred_quality
Seq('AAGAGTATTGTCACAAGACTGCTTGTTAATGCTATGCTGATTGGGCTTTGGTTG...CAC', SingleLetterAlphabet())

Reading in our sequencing reads we find a picture that's similar to the fasta files. Alas, unlike the fasta files, the fastq files contains additional metadata about our sequence, the phred_quality, which gives a quality score for each of the positions in the sequence. We can access these like this:

In [9]:
sequence.letter_annotations["phred_quality"][:10] # we only access the first 10 values, to keep things cleaner
Out[9]:
[33, 33, 33, 33, 33, 37, 37, 37, 37, 33]

Let us now try to plot the average phred-values for each position over all of our sequencing reads:

In [10]:
import matplotlib.pyplot
import numpy

# initialize empty list to store the list of quality-values per read
phred_scores_per_read = []

# read in all sequences and append the phred scores
for sequence in SeqIO.parse("sequences/rp_forward.fastq","fastq"):
    phred_scores_per_read.append(sequence.letter_annotations["phred_quality"])

# convert our "list of lists" into a proper numpy array
phred_scores_per_read = numpy.array(phred_scores_per_read)

# calculate the mean phred scores per position and 
# plot them with matplotlib

mean_phred_scores = phred_scores_per_read.mean(axis=0)
mean_phred_plot = matplotlib.pyplot.plot(mean_phred_scores)
matplotlib.pyplot.show()

Tasks

We see that the quality scores drop towards the 3' end of our sequencing reads. This can lead to problems for subsequent analyses, like when mapping the reads against a reference genome or doing a de novo genome assembly. We thus want to investigate these effects a bit more:

  1. Write a function fastq_quality() that takes a fastq file name as input parameter and returns the phred_quality values as a numpy.array()
  2. Write an function analyze() that takes the numpy.array() generated by fastq_quality() and uses matplotlib to visualize the mean, min, max phred-scores per position (c.f. the inflammation examples earlier)
  3. Generate these plots for all 6 fastq files that are contained in your sequences folder (remember the glob module). What differences do you find between the genomic read pairs (rp_*), the genomic mate pairs (mp_*) and the RNAseq read pairs (rna_*)?

Important

You might notice that the rna_forward.fastq and rna_reverse.fastq can't be handled by phred_scores_per_read.mean(axis=0). This is because the sequences in these files are of different lengths! You can get around this by making sure that all rows (i.e. each list of phred scores) have the same length nevertheless. To achieve this you can fill up the shorter rows with 0 until they are of the same length. You can use numpy to fix this:

max_len = numpy.max([len(row) for row in phred_scores])
phred_scores = numpy.asarray([numpy.pad(row, (0, max_len - len(row)), 'constant', constant_values=0) for row in phred_scores])

After modifying your phred-score numpy.array() like this you can use .mean(axis=0) as you would expect (Don't be too concerned about how this works).

In [ ]:
 
In [ ]:
 
In [ ]: